In our research, we studied the regulatory effect of miR-29c-3p on HNSCC progression. First, bioinformatics approach was utilized to find significantly differentially expressed genes in The Cancer Genome Atlas-HNSCC. Then the target miRNA and its target mRNA were screened out. Next, qRT-PCR was utilized to examine miR-29c-3p expression in HNSCC and the adjacent tissue. Western blot was introduced to test the protein level of C1QTNF6. Besides, the results of MTT, wound healing, transwell and angiogenesis assays verified the proliferation, migration, invasion and angiogenesis of HNSCC cells. Finally, the targeted relationship of miR-29c-3p and C1QTNF6 was confirmed through dual-luciferase assay. Our study found the negative correlation of miR-29c-3p and C1QTNF6 in HNSCC. Besides, overexpressed miR-29c-3p suppressed proliferation, migration, invasion, and angiogenesis of HNSCC cells. Additionally, overexpressed C1QTNF6 facilitated these biological functions of HNSCC cells while upregulating miR-29c-3p reversed such effect. Altogether, miR-29c-3p was proven to suppress the tumor-promoting effects and angiogenesis in HNSCC by targeting C1QTNF6. We also revealed a novel mechanism of HNSCC progression. MiR-29c-3p/C1QTNF6 might be a target in HNSCC treatment.

Bacteriophage Phi11 harbors a gene, gp13, encoding the putative SSB protein (GenBank accession no. NC_004615.1). SSB proteins bind to and protect the single-stranded DNA molecules from nuclease digestion and are essential for the growth and metabolic activities of the organisms encoding them. In this investigation, we have carried out the cloning, recombinant expression, and purification of rGp13 for the first time in Escherichia coli. EMSA data indicated that the purified recombinant Gp13 protein was capable of binding to single-stranded DNA. The protein exhibited maximum binding activity at 32 °C. Furthermore, our bioinformatic analysis has revealed that Gp13 consists of an OB-fold, a characteristic of SSB proteins. However, the arrangement of the OB-fold is unique, being located in the C-terminal domain of Gp13. Despite the importance of SSB proteins in various metabolic processes as well as in various types of PCR, there are no reports on the purification and characterization of SSB proteins from staphylococcal bacteriophages. We expect that the purification and characterization of recombinant Gp13 will help us gain a better insight into its biological activity and make it available in large quantities for molecular biology work.

Diabetic retinopathy (DR) is causal for visual impairment and blindness. The research aimed at whether and how lncRNA SPAG5-AS1 (SPAG5-AS1) is involved in retinal vascular dysfunction under diabetic conditions. After determination of SPAG5-AS1, miR-1224-5p, and IRS-1 expression in high glucose (HG)-treated human retinal microvascular endothelial cells (hRMECs), their respective influences on retinal vascular dysfunction was explored by cell counting kit-8, Transwell, wound-healing assay, and tube formation assay. SPAG5-AS1/miR-1224-5p/IRS-1 interaction was identified through bioinformatics analysis and luciferase reporter gene assays. As tested, SPAG5-AS1 and IRS-1 levels were induced, while miR-1224-5p was enhanced in HG-treated hRMECs. Up-regulating SPAG5-AS1 or downregulating miR-1224-5p could inhibit hRMECs proliferation, migration, and tube formation, and vice versa. SPAG5-AS1 can promote IRS-1 expression by miR-1224-5p, and depletion of IRS-1 was functional for the reversal of up-regulated SPAG5-AS1-modified influences on HG-treated hRMECs. Additionally, in diabetic rats, SPAG5-AS1 can alleviate retinal vascular dysfunction. All in all, SPAG5-AS1 attenuates diabetic retinal vascular dysfunction through miR-1224-5p/IRS-1 axis, providing a potential therapeutic strategy for DR.

Head and neck squamous cell carcinoma (HNSCC) is a lethal malignancy. Given the essential roles of E3 ligases in cancer immunotherapies, this paper explored the effect of E3 ubiquitin ligase ring finger protein 125 (RNF125) on immune escape in HNSCC. After delivering overexpressed (oe)-RNF125, interferon-gamma, or oe-programmed death-ligand 1 (PD-L1) into HNSCC cells and cell culture with carboxyfluorescein succinimidyl ester-labeled CD8+ T cells, RNF125 and PD-L1 levels were determined via RT-qPCR and Western blot, with HNSCC cell behaviors assessed via colony formation assay, Transwell assays and flow cytometry, and inflammatory factors measured via ELISA. PD-L1 ubiquitination level and PD-L1's interaction with RNF125 were analyzed via co-immunoprecipitation. The in vivo action of RNF125 on HNSCC was validated via nude mouse tumorigenicity assay. Briefly, RNF125 was weakly expressed in HNSCC cells. RNF125 overexpression inhibited immune escape of HNSCC cells, evidenced by decreased TSCCA cell proliferation, migration, and invasion, increased CD8+ T cell proliferation, and elevated IL-2 and TNF-α levels. RNF125 downregulated PD-L1 in TSCCA cells and facilitated PD-L1 ubiquitinational degradation. PD-L1 overexpression partially abated RNF125-mediated suppression on TSCCA cell immune escape. Moreover, RNF125 suppressed tumorigenesis and tumor growth in vivo. Overall, RNF125 promoted PD-L1 ubiquitinational degradation, hence inhibiting immune escape in HNSCC.

Diabetes is a serious growing concern that affects many parts of the body including the skin due to high sugar levels. Moreover, diabetic patients are at risk of developing cancer and are prone to a higher risk of hematological malignancies. In the present study, the inhibitory effect of 2'-Hydroxy-4',5'-dimethoxyacetophenone was investigated on aldose reductase and collagenase enzymes, along with docking and ADMET analysis. MTT assay was also conducted to investigate the anti-leukemic effect of 2'-Hydroxy-4',5'-dimethoxyacetophenone on human acute leukemia cells (32D-FLT3-ITD, Human HL-60/vcr, MOLT-3, and TALL-104 cell lines) and DPPH assay for establishing activity against oxidative stress. The 2'-Hydroxy-4',5'-dimethoxyacetophenone showed potent inhibition of both the above tested enzymes with numerous strong interactions with the key catalytic residues in the active site of the enzymes. The MTT assay showed strong anti-cancer activity against entire tested human acute leukemia cells and was found non-toxic to normal (HUVEC) at the tested concentration. In DPPH free radical scavenging assay, 2'-Hydroxy-4',5'-dimethoxyacetophenone showed strong inhibitory activity with IC50 of 157 µg/mL, which found comparable to the standard BHT. Our study demonstrated prominent pharmacological benefit of 2'-Hydroxy-4',5'-dimethoxyacetophenone, against various leukemic cell lines, aldose reductase and collagenase enzymes, and free radical scavenging activity.

Adenoviral vectors (AV) are commonly used as vaccine and gene therapy vehicles because of their ease of construction, ability to grow to high titers in the large-scale production process, and safety for human applications. However, the efficiency rate of downstream processes for adenoviral vectors still varies greatly. In the current study, we aimed to investigate the effect of the downstream treatment protocol and microfiltration of the harvested upstream material on viral vector yield. We compared the performance of the repeated freeze-thaw (RFT) and the Tween-20 detergent lysis (DLT) methods. In addition, the effects of the cell lysis method, incubation temperature, and time on viral yield were investigated. The samples were incubated at either room temperature or 37 °C for 1-, 2-, and 4-h periods. Samples were filtered with PES and SFCA membrane. Virus yield and infectivity were assayed by qPCR and immuno-titration. In conclusion, our results suggest that 2-h incubation gives the best results when incubated at 37 °C for denarase activity when Tween-20 is used for virus recovery. If the room temperature is preferred, 4-h incubation could be preferred. A phase 1 clinical trial (NCT05526183, January 21, 2022) was started with the recombinant adenovirus used in the study.

Crops that have been genetically modified (GM) include additional beneficial traits that present fresh approaches to boosting yield productivity and sustainable agriculture. Transformation and regeneration are the two main steps in the production of GM crops. Antibiotic resistance marker genes (ARMGs) must be used for selection because crops have very little ability to transform. Significant global concerns about the security of both human health and the environment have been raised by the use of ARMGs in the production of GM foods or for therapeutic purposes. A rise in antimicrobial resistance is the biggest danger, according to recent research. Due to a lack of information on alternate methods, ARMGs are still employed in the production of GM crops today. The creation of GM crops without ARMGs using alternative methods is crucial to addressing the safety issue. This review discusses current methods for producing GM crops free of ARMGs, or "clean-gene" technology. These methods' benefits and drawbacks are also discussed. One of them, positive selection by phosphomannose isomerase (PMI) system of different plants, has been optimized and subjected to full risk assessment and is more productive than conventional protocols that employ ARMGs. This information will be useful for enhancing breeding programs, producing safe human food, and increasing support for GM crops among the general public.

Currently, ascorbic acid (AA) is widely used as a skin whitening material, but, AA, an unstable hydrophilic molecule, cannot penetrate the skin easily, due to the hydrophobic character of the stratum corneum. Therefore, we conjugated AA with hydrated zinc oxide-an inorganic matrix with positive surface charge, to improve the stability of AA. The metal-conjugated-ascorbic acid (ZnAA) was then combined with yeast vacuole through the vacuolar membrane proteins that relate to metal transportation to create an enhanced vacuole that contained ZnAA. The characteristics of vacuole with ZnAA (ZnAA_Vac) were next examined by various tests that included X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), Field emission scanning electron microscopy (FE-SEM), and energy-dispersive X-ray (EDX) analysis. Furthermore, the ability of ZnAA_Vac to degrade melanin was confirmed in both melanoma cell line B16F10, and the artificial human skin MelanoDerm. The results showed that ZnAA_Vac possessed a higher depigmenting effect than the wild-type vacuole or ascorbic acid by reducing 75% of melanin color. Interestingly, ZnAA_Vac was found to be harmless, and did not cause any cytotoxicity to the cells. Overall, ZnAA_Vac is expected to provide a robust, harmless, and effective whitening agent for the skin.

Early diagnosis is essential for the treatment and prevention of nasopharyngeal cancer. However, there is a lack of effective biological indicators for nasopharyngeal carcinoma (NPC). Therefore, we explored the potential biomarkers in tumour-educated blood platelet (TEP) RNA in early NPC. Platelets were isolated from blood plasma and their RNA was extracted. High-throughput sequenced data from a total of 33 plasma samples were analysed using DESeq2 to identify the differentially expressed genes (DEGs). Subsequently, the DEGs were subjected to principal component analysis (PCA), gene ontology (GO) analysis, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis; and Cytoscape, TargetScan, and miRanda software were used for inferring the competing endogenous RNA network. We identified 19 long non-coding (lnc) RNAs (DElncRNAs) and 248 mRNAs (DEmRNAs) that were differentially expressed in the TEP RNA. In addition, SELP gene mRNA and lncRNAs AC092135.3, AC012358.2, AL021807.1, AP001972.5, and GPX1 were found to be down-regulated DEmRNA and DElncRNAs in the early stage of NPC. Bioinformatic analysis showed that these DEmRNAs and DElncRNAs may be involved in regulating the pathogenesis of NPC. Our research may provide new insights for exploring the biological mechanisms of NPC and early diagnosis using potential biomarkers.

A copper activated xylanase produced by E. coli BL21 was expressed in Pichia pastoris using the pGAPZαB expression vector. Two recombinant GH11 xylanase forms were obtained (N-His-rXAn11 and N-C-His-rXAn11). The findings revealed that the two recombinant xylanases displayed different behaviors toward the copper. In the presence of 3-mM Cu2+, the relative activity of the N-His-rXAn11 was enhanced by about 52%. However, the xylanase activity of the N- and C-terminal tagged one (N-C-His-rXAn11) was strongly inhibited by copper. In the presence of 3-mM Cu2+, the N-His-rXAn11 revealed to be thermostable at 60 °C with a half-life of 10 min. However, the N-C-His-rXAn11 was noted to be unstable since it was inactivated after 15 min of incubation at 55 °C. 3D models of the two recombinant forms showed that the created copper site in the N-His-rXAn11 was loosed in the C-terminal tagged protein. The C-terminal tag could trigger some structural changes with a notable displacement of secondary structures leading to great hindrance of the active site due to high fluctuations and probably new interactions among the N- and C-terminal amino acids.

Diabetes mellitus (DM) affects bone metabolism and causes osteoporosis. Musashi 1 (MSI1), a member of the Musashi family, regulates protein expression by targeting protein mRNA and has been reported to play an important role in osteogenic differentiation. Therefore, this paper attempts to explore the role of MSI1 in diabetic osteoporosis and discussing its specific mechanism. The glucose concentration for high glucose (HG) and control MC3T3-E1 cells were 30 and 5.5 mM. MC3T3-E1 cells induced by high glucose (HG) were used to simulate diabetic osteoporosis in vivo. The interaction between MSI1 and microtubule actin crosslinking factor 1 (MACF1) was confirmed by RNA Immunoprecipitation (RIP). The mRNA and protein expressions of MSI1 and MACF1 in MC3T3-E1 cells and HG-induced MC3T3-E1 cells after indicated transfection were tested by Real-time quantitative polymerase chain reaction (RT-qPCR) assay and western blot. After transfection, the proliferation, apoptosis, and osteogenic differentiation of HG-induced MC3T3-E1 cells were detected by cell counting kit (CCK)-8, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), alkaline phosphatase (ALP) activity assay, and alizarin red staining. The expression of Wnt/β-catenin signaling pathway-related proteins in HG-induced MC3T3-E1 cells after transfection was detected by western blot. This work shows that MSI1 can combine with MACF1. The expression of MSI1 and MACF1 was increased in HG-induced MC3T3-E1 cells. Upregulation of MSI1 promoted the proliferative and differentiative capabilities, but inhibited the apoptosis of HG-insulted MC3T3-E1 cells, which could be reversed by MACF1 knockdown. MSI1 stabilizes MACF1 to suppress apoptosis and promote osteogenic differentiation in HG-induced MC3T3-E1 cells by inhibiting Wnt/β-catenin signaling pathway.

The current study focuses on molecular cloning, expression and structural characterization of growth hormone-receptor (GHR) and its extracellular domain as growth hormone binding protein (GHBP) from the liver of Nili-Ravi buffalo (Bubalus bubalis; Bb). RNA was isolated, genes were amplified by reverse transcriptase-polymerase chain reaction and sequence was characterized. The BbGHR sequence showed three amino acid variations in the extracellular domain when compared with Indian BbGHR. For the production of full length BbGHR and BbGHBP in Escherichia coli (E. coli) BL21 (RIPL) Codon Plus, expression plasmids were constructed under the control of T7lac promoter and isopropyl β-D thiogalactopyranoside was used as an inducer. BbGHR and BbGHBP were expressed as inclusion bodies at ~ 40% and > 30% of the total E. coli proteins, respectively. The BbGHBP was solubilized and refolded by dilution method using cysteine-cystine redox potential. The recombinant BbGHBP was purified and biological activity was checked on HeLa cell lines showing increase cell proliferation in the presence of ovine GH (oGH), hence justifying the increase in the half-life of GH in the presence of BbGHBP. For the molecular interactions of oGH-BbGHBP multiple docking programs were employed to explore the subsequent interactions which showed high binding affinity and presence of large number of hydrogen bonds. Molecular Dynamics studies performed to examine the stability of proteins and exhibited stable structures along with favorable molecular interactions. This study has described the sequence characterization of BbGHR in Nili-Ravi buffaloes and hence provided the basis for the assessment of GH-GHR binding in other Bovidae species.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

Virus-induced gene silencing (VIGS) by deploying viral-based vectors such as tobacco rattle virus (TRV) is a homology-based gene silencing technique in post-transcriptional gene silencing (PTGS) and transcriptional gene silencing (TGS) to validate the function of particular genes. The study presented here showed the induction of DNA methylation in the promoter regions of three phenotypic marker genes in different cotton accessions, including two endogenous genes such as phytoene desaturase (PDS) and phytoene synthase (PSY), and an exogenous gene, such as green fluorescent protein (GFP). First, DNA methylation was established in transgenic GFP cotton where methylation persisted up to S3 generation. Afterward, the promoter of PSY was targeted following the same conditions. Significant silencing of PSY was observed and methylation of the promoter was found up to S2 generation in red leaf cotton as detected in GFP cotton. Silencing of PDS resulted in a photobleaching phenotype; interestingly, the strength of this phenotype was diverse within the plants and was not observed in the next generation. Bisulfite sequencing results showed methylation percentage of the cytosine residues was high at CG and CHG sites of the targeted promoter sequences in the silenced plants. The findings of this paper suggest that TRV-based vector system can be used to monitor DNA methylation for both exogenous and endogenous gene levels in cotton and offer a very useful tool for plant epigenetic modification.

Doxorubicin (DOX) is a first-line chemo drug for lymphoma treatment. DOX resistance remains a major obstacle leading to treatment failure. This study explores the interactions of the long non-coding RNA H19 (H19)/nuclear transcription factor Y subunit beta (NFYB)/mbt domain containing 1 (MBTD1) axis in DOX resistance in lymphoma cells. Bioinformatics prediction indicated a correlation between MBTD1 and advanced lymphoma stage. Elevated MBTD1 expression was detected in lymphoma cells compared to normal lymphocytes, especially in DOX-resistant lymphoma cells (OCI-Ly8/DOX and SU-DHL-2/DOX). MBTD1 silencing weakened DOX resistance in the drug-resistant cells. Bioinformatics analysis further indicated a candidate H19/NFYB/MBTD1 axis in lymphoma. Luciferase and ChIP-qPCR assays validated that NFYB bound to MBTD1 promoter to activate the MBTD1 transcription. H19 recruited NFYB to increase MBTD1 expression without altering NFYB levels. H19 silencing suppressed growth of the DOX-resistant cells in vitro and in vivo. Either NFYB or MBTD1 activation restored the DOX resistance and malignant growth of the cells. In summary, this paper demonstrates that H19 activates MBTD1 transcription in a NFYB-dependent manner to promote DOX resistance in lymphoma cells.

Hemorrhagic shock is a frequent threat to pregnant women, and blood transfusions can contribute to organ damage, including hepatic ischemia-reperfusion (HIR) injury. LncRNA SNHG7 (SNHG7) has been reported to exert an essential role in various diseases, while the effect of SNHG7 on HIR injury induced by hemorrhagic shock and reperfusion in pregnant rats is still unclear. In our study, we examined the function and mechanism of SNHG7 in the progression of HIR injury in pregnant rats. The results showed that SNHG7 expression was low in the hepatic tissues of pregnant rats after the hemorrhagic shock and reperfusion modeling. Knockdown of SNHG7 further aggravated hepatic injury, apoptosis, and oxidative stress induced by hemorrhagic shock and reperfusion during pregnancy. Additionally, SNHG7 was bound directly to miR-34a-5p, and miR-34a-5p inhibitors partially reversed the effect of SNHG7 silencing on models of hemorrhagic shock and reperfusion. Furthermore, YWHAG is a direct target of miR-34a-5p and is negatively regulated by miR-34a-5p mimics. Overexpression of YWHAG effectively eliminated the effect of SNHG7 knockdown on pregnant rats. In summary, this investigation proved that SNHG7 knockdown exacerbated HIR injury after hemorrhagic shock in pregnant rats, and reperfusion might by mediating miR-34a-5p/YWHAG axis, indicating that SNHG7 can serve as a target gene for the treatment of HIR injury caused by hemorrhagic shock and reperfusion during pregnancy.

This work aimed to describe the dynamics of the Sf9 insect cells death and primary metabolism when this host is infected simultaneously by two recombinant baculoviruses (BV) expressing rabies glycoprotein (BVG) and matrix protein (BVM) genes to produce rabies virus-like particles (VLP) at different multiplicities of infection (MOI). Schott flasks essays covering a wide range of MOI for both BV were performed. Viable cell density, cell viability, glucose, glutamine, glutamate, lactate, ammonium, and rabies proteins concentrations were monitored over the infection phase. The expression of both recombinant proteins was not limited by glucose, glutamine, and glutamate in a broad MOI (pfu/cell) range of BVG (0.15-12.5) and BVM (0.1-5.0) using SF900 III serum free culture medium. Death phase initiation and the specific death rate depend on BV MOI. The wave pattern of nutrient/metabolite profiles throughout the viral infection phase is related to the baculovirus lytic cycle. The optimal MOIs ratio between BVG (2.5-4.5) and BVM (1.0-3.0) for maximum protein expression was defined. The produced rabies VLP sizes are close to 78 nm. In general, these work outputs bring a better understanding of the metabolic performance of Sf9 cells when infected by BV for producing VLP, and specifically, for progressing in a rabies VLP vaccine development.

MicroRNAs (miRNAs) are recognized as latent diagnostic, prognostic, and therapeutic biomarkers for endometrial carcinoma (EC). We attempted to discuss function and mechanism of miR-125b-5p in EC cell progression. This study manifested a decreased miR-125b-5p level and an increased mitochondrial fission process 1 (MTFP1) level in EC, and there was an inverse correlation between them. Moreover, in vitro assays were performed. The results denoted that miR-125b-5p could target a putative binding site on MTFP1 3'UTR to reduce MTFP1 expression, thereby repressing cell malignant behaviors. Besides, the promoting impact of MTFP1 overexpression on malignant phenotypes of EC cells could be restored by miR-125b-5p up-regulation. Considering, our investigation exhibited that miR-125b-5p curbed EC cell malignant phenotypes through targeting MTFP1. This study generates a fresh functional mechanism for EC occurrence and progression, which also lays the groundwork for clinical therapies.

Multi-drug efflux is one of the resistant determinants in Klebsiella pneumoniae that are encountered in a broad range of clinically relevant antimicrobial agents. An alternative method to strategically induce sensitivity in drug-resistant K. pneumoniae and improve the efficacy of the existing antibiotics is the need of the hour. Hence, an antisense RNA was designed against the acrA gene of the AcrAB-TolC efflux system in a drug-resistant isolate of K. pneumoniae obtained from a blood culture. Minimum inhibitory concentration by E test demonstrated that the antisense RNA could significantly increase the susceptibility of previously resistant K. pneumoniae toward ciprofloxacin (CIP) and co-trimoxazole. Real-time PCR determined the ability of the antisense RNA to inhibit the expression of the acrA-mRNA. The wild-type K. pneumoniae showed increased growth in the presence of CIP, while, under the same condition, the growth of the antisense RNA-treated K. pneumoniae was inhibited up till 12 h. In the presence of co-trimoxazole, delayed growth rate of the antisense RNA-treated K. pneumoniae was seen, in comparison to that of the wild-type K. pneumoniae and also a fourfold reduction was noted in the expression of the efflux gene acrA. Our results underscore the potential of the acrA antisense RNA as an alternative therapeutic against multi-drug-resistant K. pneumoniae.

Lung cancer exists as a major risk of cancer-related death worldwide. As a novel circular RNA (circRNA), circTFF1 has not been explored in lung cancer thoroughly. This study aims to probe into the function and mechanism of circTFF1 in lung cancer. RT-qPCR and western blot were used to detect expression of RNAs and proteins. The influence of circTFF1 and BCL6B on cells behavior was explored via CCK-8 assay, colony formation assay, wound healing assay and transwell assay. Methylation of BCL6B was detected via MSP assay. Bioinformatics analysis and mechanism assays were conducted for investigating the interaction among genes. CircTFF1 was found to be upregulated in lung cancer cell lines used in this study. Functional experiments revealed circTFF1 facilitated cell proliferation, migration and invasion. BCL6B was downregulated in lung cancer cell lines used in this study, and the downregulation of BCL6B was mainly mediated by methylation. Additionally, BCL6B exerted suppressive impacts on lung cancer cell line malignant behavior. Moreover, circTFF1 acted as the miR-29c-3p sponge to upregulate DNMT3A, which facilitated the methylation of BCL6B. In all, circTFF1 promoted proliferation, migration and invasion of lung cancer cell lines by facilitating methylation of BCL6B promoter via miR-29c-3p/DNMT3A axis.

Despite major advances in combating pathogenic bacteria caused infection, infectious diseases remain a major cause of death today. A variety of bacteria detection approaches have been established by exploiting the aptamer to specifically identify target. However, these methods require specific equipment or laboratory based instruments, which is expensive and not easily available to the public. To deal with this issue, we develop here a portable and sensitive pathogenic bacteria detection approach through integrating capture probe based recognition and Exo-III assisted signal amplification. In this method, a designed capture probe identifies the surface protein of target bacteria, leading to the release of blocker sequence. The released blocker sequence mediates Exo-III enzyme based signal amplification, generating a large amount of signal strand DNA (ssDNA) sequences. The obtained ssDNA works as a linker to conjugate streptavidin magnetic beads (SMBs) with DNA invertase. After magnet based enrichment and washing away of free DNA invertase, the SMBs-DNA invertase complex is used to catalyze the hydrolysis of sucrose into glucose for PGM readout. Based on this, the approach exhibits a 6 order of magnitudes in detecting Staphylococcus Aureus (S. aureus) with the limit of detection as low as 78 cfu/mL. In addition, the capability to specifically detect target bacteria and high repeatability (relative standard deviation, 4.44%) endows the method wider applicable scenes. In all, the established shows a promising prospect in the detection of bacteria pathogen and the early-diagnosis of bacterial infections.

Monkeypox Virus (MPXV), the causative agent of Monkeypox (MPX) disease, is an emerging zoonotic pathogen spreading in different endemic and non-endemic nations and creating outbreaks. MPX treatment mainly includes Cidofovir and Tecovirimat but they have several side effects and solely depending on these drugs may promote the emergence of drug-resistant variants. Hence, new drugs are required to control the spread of the disease. In this study, we explored the MPXV proteome to suggest repurposable drugs. DrugBank screening revealed drugs such as Brinzolamide, Dorzolamide, Methazolamide, Zidovudine, Gemcitabine, Hydroxyurea, Fludarabine, and Tecovirimat as controls. Structural analogs of these compounds were extracted from ChEMBL Database. After Molecular docking and Absorption, Distribution, Metabolism, Excretion, and Toxicity (ADMET)-based screening, we identified Zidovudine (binding affinity-5.9 kcal/mol) and a Harmala alkaloid (2S,4R)-4-(9H-Pyrido[3,4-b]indol-1-yl)-1,2,4-butanetriol (binding affinity - 6.6 kcal/mol) against L2R receptor (Thymidine Kinase). Moreover, Fludarabine (binding affinity - 6.4 kcal/mol) and 5'-Dehydroadenosine (binding affinity - 6.4 kcal/mol) can strongly interact with the I4L receptor (Ribonucleotide reductase large subunit R1). Molecular Dynamics (MD) simulations suggest all of these compounds can change the C-alpha backbone, residue mobility, compactness, and solvent accessible surface area of L2R and I4L. Our results strongly suggest that these drug repurposing small molecules are worth exploring in vivo and in vitro for clinical applications.

Microbial lipases expedite the hydrolysis and synthesis of long-chain acyl esters. They are highly significant commercial biocatalysts to biotechnologists and organic chemists. The market size of lipase is anticipated to reach $590 million by 2023. This is all owing to their versatility in properties, including stability in organic solvents, interfacial activation in micro-aqueous environments, high substrate specificity, and activity in even non-aqueous milieu. Lipases are omnipresent and synthesized by various living organisms, including animals, plants, and microorganisms. Microbial lipases are the preferred choice for industrial applications as they entail low production costs, higher yield independent of seasonal changes, easier purification practices, and are capable of being genetically modified. Microbial lipases are employed in several common industries, namely various food manufactories (dairy, bakery, flavor, and aroma enhancement, etc.), leather tanneries, paper and pulp, textiles, detergents, cosmetics, pharmaceuticals, biodiesel synthesis, bioremediation and waste treatment, and many more. In recent decades, circumspection toward eco-friendly and sustainable energy has led scientists to develop industrial mechanisms with lesser waste/effluent generation, minimal overall energy usage, and biocatalysts that can be synthesized using renewable, low-cost, and unconventional raw materials. However, there are still issues regarding the commercial use of lipases which make industrialists wary and sometimes even switch back to chemical catalysis. Industrially relevant lipase properties must be further optimized, analyzed, and explored to ensure their continuous successful utilization. This review comprehensively describes the general background, structural characteristics, classifications, thermostability, and various roles of bacterial lipases in important industries.